Stem-loop sequence sla-mir-128

AccessionMI0002521 (change log)
Previous IDssla-mir-128a
DescriptionSaguinus labiatus miR-128 stem-loop
Gene family MIPF0000048; mir-128
Stem-loop
   u    u      uuc       uag      cu       u 
5'  gagc guugga   ggggccg   cacugu  gagaggu u
    |||| ||||||   |||||||   ||||||  |||||||  
3'  uucg cgacuu   cucuggc   gugaca  cucuuua a
   c    u      uuu       caa      --       c 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Database links

Mature sequence sla-miR-128

Accession MIMAT0002232
Previous IDssla-miR-128a
Sequence

50 - 

ucacagugaaccggucucuuuu

 - 71

Get sequence
Evidence by similarity; MI0000447

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).