Stem-loop sequence mml-mir-145

AccessionMI0002558 (change log)
DescriptionMacaca mulatta miR-145 stem-loop
Gene family MIPF0000079; mir-145
Literature search

3 open access papers mention mml-mir-145
(10 sentences)

Stem-loop
   c   u  u     c  uc    u  c            uaaau 
5'  acc ug ccuca gg  cagu uu ccaggaaucccu     g
    ||| || ||||| ||  |||| || ||||||||||||     c
3'  ugg ac ggagu uc  guca aa gguccuuagggg     u
   u   u  u     -  uu    u  a            uagaa 
Get sequence
Deep sequencing
52363 reads, 256 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [2]. The expression of this mature miRNA was validated by Miska et al [1].

Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr6: 147552171-147552258 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-145
mml-mir-143chr6: 147550465-147550570 [+]
mml-mir-145chr6: 147552171-147552258 [+]
Database links

Mature sequence mml-miR-145-5p

Accession MIMAT0002266
Sequence

16 - 

guccaguuuucccaggaaucccuu

 - 39

Get sequence
Deep sequencing24906 reads, 9 experiments
Evidence experimental; cloned [1], Illumina [3]
Database links
Predicted targets

Mature sequence mml-miR-145-3p

Accession MIMAT0026568
Sequence

54 - 

ggauuccuggaaauacuguucuu

 - 76

Get sequence
Deep sequencing27440 reads, 9 experiments
Evidence experimental; Illumina [3]
Database links
Predicted targets

References

1
PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
2
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).
3
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).