Stem-loop sequence ggo-mir-145

AccessionMI0002560 (change log)
DescriptionGorilla gorilla miR-145 stem-loop
Gene family MIPF0000079; mir-145
Literature search

1 open access papers mention ggo-mir-145
(3 sentences)

Stem-loop
   c   u  u     c  uc    u  c            uagau 
5'  acc ug ccuca gg  cagu uu ccaggaaucccu     g
    ||| || ||||| ||  |||| || ||||||||||||     c
3'  ugg ac ggagu uc  guca aa gguccuuagggg     u
   u   u  u     -  uu    u  a            uagaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (GorGor4; GCA_000151905.3) Overlapping transcripts
chr5: 133117057-133117144 [+]
intergenic
Clustered miRNAs
< 10kb from ggo-mir-145
ggo-mir-143chr5: 133115327-133115432 [+]
ggo-mir-145chr5: 133117057-133117144 [+]
Database links

Mature sequence ggo-miR-145

Accession MIMAT0002268
Sequence

16 - 

guccaguuuucccaggaaucccuu

 - 39

Get sequence
Evidence by similarity; MI0000461

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).