Stem-loop sequence ppy-mir-134

AccessionMI0002590 (change log)
DescriptionPongo pygmaeus miR-134 stem-loop
Gene family MIPF0000112; mir-134
Stem-loop
   c     gu        u  -a   g    ---    g 
5'  agggu  gugacugg ug  cca aggg   gcau c
    |||||  |||||||| ||  ||| ||||   |||| a
3'  uccca  cacugauc ac  ggu uccc   ugug c
   c     ac        c  cg   g    acu    u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr14: 102616871-102616943 [+]
intergenic
Clustered miRNAs
< 10kb from ppy-mir-134
ppy-mir-381chr14: 102608058-102608132 [+]
ppy-mir-487bchr14: 102608591-102608674 [+]
ppy-mir-539chr14: 102609453-102609530 [+]
ppy-mir-889chr14: 102610033-102610111 [+]
ppy-mir-544chr14: 102610806-102610896 [+]
ppy-mir-655chr14: 102611698-102611794 [+]
ppy-mir-487achr14: 102614611-102614690 [+]
ppy-mir-382chr14: 102616490-102616565 [+]
ppy-mir-134chr14: 102616871-102616943 [+]
ppy-mir-668chr14: 102617958-102618024 [+]
ppy-mir-485chr14: 102618120-102618192 [+]
ppy-mir-453chr14: 102618891-102618970 [+]
ppy-mir-154chr14: 102622472-102622555 [+]
ppy-mir-496chr14: 102623301-102623402 [+]
ppy-mir-377chr14: 102624784-102624852 [+]
Database links

Mature sequence ppy-miR-134

Accession MIMAT0002289
Sequence

8 - 

ugugacugguugaccagaggg

 - 28

Get sequence
Evidence by similarity; MI0000474

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).