Stem-loop sequence ptr-mir-154

AccessionMI0002597 (change log)
DescriptionPan troglodytes miR-154 stem-loop
Gene family MIPF0000018; mir-154
Literature search

1 open access papers mention ptr-mir-154
(1 sentences)

Stem-loop
   g       u            u      ugcc    - uuu 
5'  ugguacu gaagauagguua ccgugu    uucg c   a
    ||||||| |||||||||||| ||||||    |||| |   u
3'  accauga uuuuuauccagu ggcaca    aagc g   u
   a       c            u      uacu    a ugu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr14: 86308003-86308086 [+]
intergenic
Clustered miRNAs
< 10kb from ptr-mir-154
ptr-mir-487achr14: 86300680-86300758 [+]
ptr-mir-382chr14: 86302540-86302614 [+]
ptr-mir-134chr14: 86302921-86302992 [+]
ptr-mir-668chr14: 86303493-86303557 [+]
ptr-mir-485chr14: 86303654-86303725 [+]
ptr-mir-453chr14: 86304425-86304503 [+]
ptr-mir-154chr14: 86308003-86308086 [+]
ptr-mir-496chr14: 86308822-86308922 [+]
ptr-mir-377chr14: 86310299-86310366 [+]
ptr-mir-409chr14: 86313550-86313627 [+]
ptr-mir-412chr14: 86313697-86313786 [+]
ptr-mir-369chr14: 86313848-86313916 [+]
ptr-mir-410chr14: 86314162-86314240 [+]
ptr-mir-656chr14: 86314977-86315053 [+]
Database links

Mature sequence ptr-miR-154

Accession MIMAT0002296
Sequence

15 - 

uagguuauccguguugccuucg

 - 36

Get sequence
Evidence by similarity; MI0000480
Predicted targets

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).