Stem-loop sequence ppy-mir-154

AccessionMI0002599 (change log)
DescriptionPongo pygmaeus miR-154 stem-loop
Gene family MIPF0000018; mir-154
Stem-loop
   g       u            u      ugcc    - uuu 
5'  ugguacu gaagauagguua ccgugu    uucg c   a
    ||||||| |||||||||||| ||||||    |||| |   u
3'  accauga uuuuuauccagu ggcaca    aagc g   u
   a       c            u      uacu    a ugu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr14: 102622472-102622555 [+]
intergenic
Clustered miRNAs
< 10kb from ppy-mir-154
ppy-mir-487achr14: 102614611-102614690 [+]
ppy-mir-382chr14: 102616490-102616565 [+]
ppy-mir-134chr14: 102616871-102616943 [+]
ppy-mir-668chr14: 102617958-102618024 [+]
ppy-mir-485chr14: 102618120-102618192 [+]
ppy-mir-453chr14: 102618891-102618970 [+]
ppy-mir-154chr14: 102622472-102622555 [+]
ppy-mir-496chr14: 102623301-102623402 [+]
ppy-mir-377chr14: 102624784-102624852 [+]
ppy-mir-541chr14: 102627217-102627300 [+]
ppy-mir-409chr14: 102628022-102628100 [+]
ppy-mir-412chr14: 102628169-102628259 [+]
ppy-mir-369chr14: 102628320-102628389 [+]
ppy-mir-410chr14: 102628634-102628713 [+]
ppy-mir-656chr14: 102629436-102629513 [+]
Database links

Mature sequence ppy-miR-154

Accession MIMAT0002298
Sequence

15 - 

uagguuauccguguugccuucg

 - 36

Get sequence
Evidence by similarity; MI0000480

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).