Stem-loop sequence ptr-mir-184

AccessionMI0002602 (change log)
DescriptionPan troglodytes miR-184 stem-loop
Gene family MIPF0000059; mir-184
Literature search

1 open access papers mention ptr-mir-184
(14 sentences)

Stem-loop 
   c       g c         c      a c     -    ug 
5'  cagucac u cccuuauca uuuucc g ccagc uuug  a
    ||||||| | ||||||||| |||||| | ||||| ||||   
3'  guuagug a gggaauagu aagagg c gguug gaau  c
   a       g u         c      - a     u    gu
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr15: 60305431-60305514 [+]
intergenic
Database links

Mature sequence ptr-miR-184

Accession MIMAT0002301
Sequence

53 -  

uggacggagaacugauaagggu

 - 74

Get sequence
Evidence by similarity; MI0000481
Predicted targets

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).