![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence ptr-mir-184 |
|||||
Accession | MI0002602 (change log) | ||||
Description | Pan troglodytes miR-184 stem-loop | ||||
Gene family | MIPF0000059; mir-184 | ||||
Literature search |
![]()
1 open access papers mention ptr-mir-184 | ||||
Stem-loop |
c g c c a c - ug 5' cagucac u cccuuauca uuuucc g ccagc uuug a ||||||| | ||||||||| |||||| | ||||| |||| 3' guuagug a gggaauagu aagagg c gguug gaau c a g u c - a u gu |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Comments |
Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated. |
||||
Genome context |
|
||||
Database links |
Mature sequence ptr-miR-184 |
|
Accession | MIMAT0002301 |
Sequence |
53 - uggacggagaacugauaagggu - 74 |
Evidence | by similarity; MI0000481 |
Predicted targets |
|
References |
|
1 |
PMID:15652478
"Phylogenetic shadowing and computational identification of human microRNA genes"
Cell. 120:21-24(2005).
|