Stem-loop sequence ptr-mir-188

Accession MI0002609
Description Pan troglodytes miR-188 stem-loop
Gene family MIPF0000113; mir-188
Stem-loop 
u    -  uc   ca  uc         gu      ugaacuu 
 gcuc cc  ucu  ca  ccuugcaug  ggaggg       u
 |||| ||  |||  ||  |||||||||  ||||||        
 cgag gg  agg  gu  gggacguac  ccuccc       c
c    c  -u   ac  uu         ac      caaaagu
Get sequence
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (PanTro2.1.4) Overlapping transcripts
X: 50088957-50089042 [+]
sense
Clustered miRNAs
< 10kb from ptr-mir-188
ptr-mir-532 X: 50088603-50088692 [+]
ptr-mir-188 X: 50088957-50089042 [+]
ptr-mir-500-1 X: 50094160-50094242 [+]
ptr-mir-362 X: 50094693-50094756 [+]
ptr-mir-501 X: 50095453-50095535 [+]
ptr-mir-500-2 X: 50096400-50096478 [+]
Database links

Mature sequence ptr-miR-188

Accession MIMAT0002308
Sequence

15 -  

caucccuugcaugguggagggu

 - 36

Get sequence
Evidence by similarity; MI0000484
Predicted targets

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).