Stem-loop sequence mml-mir-21

AccessionMI0002621 (change log)
DescriptionMacaca mulatta miR-21 stem-loop
Gene family MIPF0000060; mir-21
Literature search

7 open access papers mention mml-mir-21
(95 sentences)

Stem-loop
   u     gu        a     a     a    u a 
5'  gucgg  agcuuauc gacug uguug cugu g a
    |||||  |||||||| ||||| ||||| |||| | u
3'  caguc  ucggguag cugac acaac ggua c c
   a     ug        -     c     -    - u 
Get sequence
Deep sequencing
2253797 reads, 1.75e+04 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr16: 53341909-53341980 [+]
sense
ENSMMUT00000023264 ; APPBP2-201; intron 10
Database links

Mature sequence mml-miR-21-5p

Accession MIMAT0002320
Sequence

8 - 

uagcuuaucagacugauguuga

 - 29

Get sequence
Deep sequencing2253245 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence mml-miR-21-3p

Accession MIMAT0026573
Sequence

46 - 

caacaccagucgaugggcuguc

 - 67

Get sequence
Deep sequencing545 reads, 9 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).