Stem-loop sequence mml-mir-30a

AccessionMI0002666 (change log)
DescriptionMacaca mulatta miR-30a stem-loop
Gene family MIPF0000005; mir-30
Literature search

4 open access papers mention mml-mir-30a
(9 sentences)

Stem-loop
      a            uc           -----   a 
5' gcg cuguaaacaucc  gacuggaagcu     gug a
   ||| ||||||||||||  |||||||||||     |||  
3' cgu gacguuuguagg  cugacuuucgg     uac g
      c            --           guaga   c 
Get sequence
Deep sequencing
11730247 reads, 7.75e+04 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr4: 69466191-69466261 [-]
intergenic
Database links

Mature sequence mml-miR-30a-5p

Accession MIMAT0002369
Sequence

6 - 

uguaaacauccucgacuggaag

 - 27

Get sequence
Deep sequencing10951367 reads, 9 experiments
Evidence by similarity; MI0000088
Database links
Predicted targets

Mature sequence mml-miR-30a-3p

Accession MIMAT0002370
Sequence

47 - 

cuuucagucggauguuugcagc

 - 68

Get sequence
Deep sequencing778879 reads, 9 experiments
Evidence by similarity; MI0000088
Database links
Predicted targets

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).