Stem-loop sequence mml-mir-98

AccessionMI0002696 (change log)
DescriptionMacaca mulatta miR-98 stem-loop
Gene family MIPF0000002; let-7
Literature search

1 open access papers mention mml-mir-98
(1 sentences)

Stem-loop
   gu                 u    ---------      aggg 
5'   gagguaguaaguuguau guug         uggggu    a
     ||||||||||||||||| ||||         ||||||    u
3'   uuucaucauucaacaua caau         accccg    a
   cc                 u    agaagauua      gauu 
Get sequence
Deep sequencing
9353167 reads, 6.76e+04 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chrX: 52963138-52963217 [-]
sense
ENSMMUT00000007642 ; WNK3-201; intron 1
ENSMMUT00000007643 ; WNK3-202; intron 1
Clustered miRNAs
< 10kb from mml-mir-98
mml-let-7f-2chrX: 52964085-52964167 [-]
mml-mir-98chrX: 52963138-52963217 [-]
Database links

Mature sequence mml-miR-98

Accession MIMAT0002404
Sequence

2 - 

ugagguaguaaguuguauuguu

 - 23

Get sequence
Deep sequencing9353136 reads, 9 experiments
Evidence by similarity; MI0000100
Database links
Predicted targets

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).