Stem-loop sequence ptr-mir-98

AccessionMI0002697 (change log)
DescriptionPan troglodytes miR-98 stem-loop
Gene family MIPF0000002; let-7
Stem-loop
   a    uc    -          u                 u    ---------      aggg 
5'  ggau  ugcu caugccaggg gagguaguaaguuguau guug         uggggu    a
    ||||  |||| |||||||||| ||||||||||||||||| ||||         ||||||    u
3'  cuua  acgg gugugguccc uuucaucauucaacaua caau         accccg    a
   a    -u    u          -                 u    agaagauua      gauu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chrX: 53203082-53203200 [-]
sense
ENSPTRT00000049267 ; HUWE1-201; intron 45
Clustered miRNAs
< 10kb from ptr-mir-98
ptr-let-7f-2chrX: 53204052-53204133 [-]
ptr-mir-98chrX: 53203082-53203200 [-]
Database links

Mature sequence ptr-miR-98

Accession MIMAT0002405
Sequence

22 - 

ugagguaguaaguuguauuguu

 - 43

Get sequence
Evidence by similarity; MI0000100
Predicted targets

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).