Stem-loop sequence ppa-mir-101

Accession MI0002720
Description Pan paniscus miR-101 stem-loop
Gene family MIPF0000046; mir-101
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-101_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-101 microRNA precursor is a small non-coding RNA that regulates gene expression. Expression of miR-101 has been validated in both human (MI0000103, MI0000739) and mouse (MI0000148). This microRNA appears to be specific to the vertebrates and has now been predicted or confirmed in a wide range of vertebrate species (MIPF0000046). The precursor microRNA is a stem-loop structure of about 70 nucleotides in length that is processed by the Dicer enzyme to form the 21-24 nucleotide mature microRNA. In this case the mature sequence is excised from the 3' arm of the hairpin.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop 
u   cuggc                  a    gucca 
 gcc     ucaguuaucacagugcug ugcu     u
 |||     |||||||||||||||||| ||||      
 cgg     agucaauagugucaugac augg     u
a   uagga                  -    aaauc
Get sequence
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Database links

Mature sequence ppa-miR-101

Accession MIMAT0002428
Sequence

47 -  

uacaguacugugauaacugaag

 - 68

Get sequence
Evidence by similarity; MI0000103
Predicted targets

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).