Stem-loop sequence mml-mir-181a-2

AccessionMI0002808 (change log)
Previous IDsmml-mir-181a
DescriptionMacaca mulatta miR-181a-2 stem-loop
Gene family MIPF0000007; mir-181
Literature search

3 open access papers mention mml-mir-181a-2
(33 sentences)

Stem-loop
   agaagggcuaucaggccagccuuca         a   a   u      cu       a    ggga 
5'                          gaggacucc agg aca ucaacg  gucggug guuu    u
                            ||||||||| ||| ||| ||||||  ||||||| ||||    u
3'                          uuccugggg ucc ugu aguugc  cagucac caaa    u
   ------------------------a         c   a   c      --       -    aaag 
Get sequence
Deep sequencing
2586412 reads, 1.51e+04 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [2]. The expression of this mature miRNA was validated by Miska et al [1].

Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr15: 14342713-14342822 [-]
sense
ENSMMUT00000022186 ; AUH-201; intron 3
ENSMMUT00000045783 ; AUH-202; intron 3
Clustered miRNAs
< 10kb from mml-mir-181a-2
mml-mir-181a-2chr15: 14342713-14342822 [-]
mml-mir-181b-2chr15: 14341488-14341576 [-]
Database links

Mature sequence mml-miR-181a-5p

Accession MIMAT0002506
Previous IDsmml-miR-181a
Sequence

39 - 

aacauucaacgcugucggugagu

 - 61

Get sequence
Deep sequencing5130597 reads, 9 experiments
Evidence by similarity; MI0000289
Database links
Predicted targets

References

1
PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
2
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).