Stem-loop sequence mml-mir-182

AccessionMI0002815 (change log)
DescriptionMacaca mulatta miR-182 stem-loop
Gene family MIPF0000116; mir-182
Literature search

1 open access papers mention mml-mir-182
(2 sentences)

Stem-loop
   caca    -  -u   uc -      uu       u -g      uca      ugaggu 
5'     gcug cu  gcc  c cccugu  uuggcaa g  uagaac   cacugg      a
       |||| ||  |||  | ||||||  ||||||| |  ||||||   ||||||       
3'     cggc ga  cgg  g ggggca  aaccguu c  aucuug   guggcc      a
   --ca    c  cu   ga c      uc       - ag      ---      uagggu 
Get sequence
Deep sequencing
70839 reads, 389 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr3: 155854815-155854926 [-]
intergenic
Clustered miRNAs
< 10kb from mml-mir-182
mml-mir-183chr3: 155860330-155860439 [-]
mml-mir-96chr3: 155860126-155860203 [-]
mml-mir-182chr3: 155854815-155854926 [-]
Database links

Mature sequence mml-miR-182

Accession MIMAT0002513
Sequence

25 - 

uuuggcaaugguagaacucaca

 - 46

Get sequence
Deep sequencing70837 reads, 9 experiments
Evidence by similarity; MI0000272
Database links
Predicted targets

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).