|
miRBase |
|
Stem-loop sequence ppy-mir-182 |
||||||||
| Accession | MI0002816 | |||||||
| Description | Pongo pygmaeus miR-182 stem-loop | |||||||
| Gene family | MIPF0000116; mir-182 | |||||||
| Stem-loop |
caca - --ug c uu u -g uca ugaggu gcug cu ccuu ccccgu uuggcaa g uagaac cacugg a |||| || |||| |||||| ||||||| | |||||| |||||| cggc ga ggag ggggua aaccguu c aucuug guggcc a --ca c cuca c uc - ag --- uaggac |
|||||||
| Comments |
Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated. |
|||||||
| Genome context |
|
|||||||
| Clustered miRNAs |
|
|||||||
| Database links |
|
|||||||
Mature sequence ppy-miR-182 |
|
| Accession | MIMAT0002514 |
| Sequence |
25 - uuuggcaaugguagaacucaca - 46 |
| Evidence | by similarity; MI0000272 |
| Predicted targets |
|
References |
|
| 1 |
PMID:15652478
"Phylogenetic shadowing and computational identification of human microRNA genes"
Cell. 120:21-24(2005).
|