Stem-loop sequence mml-mir-199a-1

AccessionMI0002834 (change log)
Previous IDsmml-mir-199a
DescriptionMacaca mulatta miR-199a-1 stem-loop
Gene family MIPF0000040; mir-199
Literature search

2 open access papers mention mml-mir-199a-1
(2 sentences)

Stem-loop
   aggaa   u  ggaga    -    c   gcc       u        c   --uca  ac 
5'      gcu cu     uccu gcuc guc   ccagugu cagacuac ugu     gg  a
        ||| ||     |||| |||| |||   ||||||| |||||||| |||     ||   
3'      cga ga     ggga cggg cag   gguuaca gucugaug aca     cc  a
   ----a   -  -----    a    u   auu       c        -   uguug  gu 
Get sequence
Deep sequencing
193708 reads, 1.43e+03 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr1: 195411983-195412092 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-199a-1
mml-mir-199a-1chr1: 195411983-195412092 [+]
mml-mir-214chr1: 195417710-195417819 [+]
Database links

Mature sequence mml-miR-199a

Accession MIMAT0002531
Sequence

31 - 

cccaguguucagacuaccuguuc

 - 53

Get sequence
Deep sequencing15027 reads, 9 experiments
Evidence by similarity; MI0000281
Predicted targets

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).