Stem-loop sequence ptr-mir-181b-1

Accession MI0002934
Previous IDs ptr-mir-181b
Description Pan troglodytes miR-181b-1 stem-loop
Gene family MIPF0000007; mir-181
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-181_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology miR-181 microRNA precursor is a small non-coding RNA molecule. MicroRNAs (miRNAs) are transcribed as ~70 nucleotide precursors and subsequently processed by the RNase-III type enzyme Dicer to give a ~22 nucleotide mature product. In this case the mature sequence comes from the 5' arm of the precursor. They target and modulate protein expression by inhibiting translation and / or inducing degradation of target messenger RNAs. This new class of genes has recently been shown to play a central role in malignant transformation. miRNA are downregulated in many tumors and thus appear to function as tumor suppressor genes. The mature products miR-181a, miR-181b, miR-181c or miR-181d are thought to have regulatory roles at posttranscriptional level, through complementarity to target mRNAs. miR-181 which has been predicted or experimentally confirmed in a wide number of vertebrate species as rat, zebrafish, and in the pufferfish (see below) (MIPF0000007).

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
ccugugcagagauuauuuuuuaaaa       aucaa         cug          gaa  g 
                         ggucaca     cauucauug   ucgguggguu   cu u
                         |||||||     |||||||||   ||||||||||   ||  
                         ccggugu     guaaguaac   agucacucga   gg g
---------------------cgcc       -caac         --a          aca  u 
Get sequence
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (PanTro2.1.4) Overlapping transcripts
1: 177581654-177581761 [-]
sense
Clustered miRNAs
< 10kb from ptr-mir-181b-1
ptr-mir-181a-1 1: 177581823-177581932 [-]
ptr-mir-181b-1 1: 177581654-177581761 [-]
Database links

Mature sequence ptr-miR-181b

Accession MIMAT0002625
Sequence

36 - 

aacauucauugcugucggugggu

 - 58

Get sequence
Evidence by similarity; MI0000270
Predicted targets

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).