Stem-loop sequence mml-mir-19b-1

AccessionMI0003005 (change log)
DescriptionMacaca mulatta miR-19b-1 stem-loop
Gene family MIPF0000011; mir-19
Literature search

3 open access papers mention mml-mir-19b-1
(4 sentences)

Stem-loop
        uu                 -  -      uc    ugugu 
5' cacug  cuaugguuaguuuugca gg uuugca  cagc     g
   |||||  ||||||||||||||||| || ||||||  ||||     a
3' gugau  ggugucagucaaaacgu cc aaacgu  gucg     u
        --                 a  u      --    ucuua 
Get sequence
Deep sequencing
7263 reads, 22.2 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr17: 73096694-73096780 [+]
sense
ENSMMUT00000015929 ; GPC5-201; intron 1
Clustered miRNAs
< 10kb from mml-mir-19b-1
mml-mir-17chr17: 73096107-73096190 [+]
mml-mir-18achr17: 73096253-73096323 [+]
mml-mir-19achr17: 73096393-73096474 [+]
mml-mir-20achr17: 73096567-73096637 [+]
mml-mir-19b-1chr17: 73096694-73096780 [+]
mml-mir-92a-1chr17: 73096816-73096893 [+]
Database links

Mature sequence mml-miR-19b

Accession MIMAT0002705
Sequence

54 - 

ugugcaaauccaugcaaaacuga

 - 76

Get sequence
Deep sequencing14456 reads, 9 experiments
Evidence by similarity; MI0000075
Database links
Predicted targets

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).