Stem-loop sequence ppy-mir-93

AccessionMI0003068 (change log)
DescriptionPongo pygmaeus miR-93 stem-loop
Gene family MIPF0000001; mir-17
Literature search

1 open access papers mention ppy-mir-93
(2 sentences)

Stem-loop
             -ca       -     u    g   ug  au 
5' cugggggcuc   aagugcu guucg gcag uag  ug  u
   ||||||||||   ||||||| ||||| |||| |||  ||   
3' ggcccccgag   uucacga cgagu cguc auc  gc  a
             ccc       u     -    -   ca  cc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr7: 9079061-9079140 [-]
intergenic
Clustered miRNAs
< 10kb from ppy-mir-93
ppy-mir-106bchr7: 9079286-9079367 [-]
ppy-mir-93chr7: 9079061-9079140 [-]
ppy-mir-25chr7: 9078853-9078936 [-]
Database links

Mature sequence ppy-miR-93

Accession MIMAT0002767
Sequence

12 - 

aaagugcuguucgugcagguag

 - 33

Get sequence
Evidence by similarity; MI0000095

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).