Stem-loop sequence sla-mir-93

Accession MI0003077
Description Saguinus labiatus miR-93 stem-loop
Gene family MIPF0000001; mir-17
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-17_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-17 microRNA precursor family are a group of related small non-coding RNA genes called microRNAs that regulate gene expression. The microRNA precursor miR-17 family, includes miR-20, miR-91, and miR-103. miRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In this case the mature sequence comes from the 3' arm of the precursor. The products are thought to have regulatory roles through complementarity to the 3' UTR of mRNA. A screen of 17 miRNAs that have been predicted to regulate a number of breast cancer associated genes found variations in the microRNAs miR-17 and miR-30c-1, these patients were noncarriers of BRCA1 or BRCA2 mutations, lending the possibility that familial breast cancer may be caused by variation in these miRNAs.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
          -ca       -     u    g   ug  au 
cugggggcuc   aagugcu guucg gcag uag  ug  u
||||||||||   ||||||| ||||| |||| |||  ||   
ggcccccgag   uucacga cgagu cguc auc  ac  a
          ccc       u     -    -   ca  cc 
Get sequence
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Database links

Mature sequence sla-miR-93

Accession MIMAT0002776
Sequence

12 - 

aaagugcuguucgugcagguag

 - 33

Get sequence
Evidence by similarity; MI0000095
Predicted targets

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).