miRBase entry: mml-mir-96

Stem-loop mml-mir-96


Accession
MI0003085
Description
Macaca mulatta mml-mir-96 precursor miRNA

Literature search
1 open access papers mention mml-mir-96
(1 sentences)

Sequence

1244 reads, 10 reads per million, 8 experiments
uggccgauUUUGGCACUAGCACAUUUUUGCuugugucucuccgcucugagcaaucaugugcagugccaauaugggaaa
...((.((.((((((((.((((((..(((((((((......)))...))))))..)))))))))))))).)).))...

Structure
ugg  g  U        A      UU      ---   uc 
   cc au UUGGCACU GCACAU  UUGCuu   gug  u
   || || |||||||| ||||||  ||||||   |||   
   gg ua aaccguga cgugua  aacgag   cgc  c
aaa  g  u        -      cu      ucu   cu 


Annotation confidence Not enough data
Do you think this miRNA is real?
Comments
Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
chr3: 155860126-155860203 [-]
Clustered miRNAs
2 other miRNAs are < 10 kb from mml-mir-96
Name Accession Chromosome Start End Strand Confidence




Database links

Mature mml-miR-96

Accession MIMAT0002784
Description Macaca mulatta mml-miR-96 mature miRNA
Sequence 9 - UUUGGCACUAGCACAUUUUUGC - 30
Evidence not_experimental

References

  1. PubMed ID: 15652478
    Phylogenetic shadowing and computational identification of human microRNA genes
    "Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E"
    "Cell (2005) 120:21-24