Stem-loop sequence mml-mir-96

AccessionMI0003085 (change log)
DescriptionMacaca mulatta miR-96 stem-loop
Gene family MIPF0000072; mir-96
Literature search

1 open access papers mention mml-mir-96
(1 sentences)

Stem-loop
   ugg  g  u        a      uu      ---   uc 
5'    cc au uuggcacu gcacau  uugcuu   gug  u
      || || |||||||| ||||||  ||||||   |||   
3'    gg ua aaccguga cgugua  aacgag   cgc  c
   aaa  g  u        -      cu      ucu   cu 
Get sequence
Deep sequencing
1429 reads, 0 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr3: 155860126-155860203 [-]
intergenic
Clustered miRNAs
< 10kb from mml-mir-96
mml-mir-183chr3: 155860330-155860439 [-]
mml-mir-96chr3: 155860126-155860203 [-]
mml-mir-182chr3: 155854815-155854926 [-]
Database links

Mature sequence mml-miR-96

Accession MIMAT0002784
Sequence

9 - 

uuuggcacuagcacauuuuugc

 - 30

Get sequence
Deep sequencing1383 reads, 9 experiments
Evidence by similarity; MI0000098
Predicted targets

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).