|
miRBase |
|
Stem-loop sequence ggo-mir-183 |
||||||||
| Accession | MI0003088 | |||||||
| Description | Gorilla gorilla miR-183 stem-loop | |||||||
| Gene family | MIPF0000066; mir-183 | |||||||
| Stem-loop |
ccgcaga u ---c - g --ac ga -- ac gug ga uc cuguucugu uauggc uggua auucacug uga a ||| || || ||||||||| |||||| ||||| |||||||| ||| cac cu ag gacgagaca auaccg gccau uaagugac acu g -----ag - agac a a ggaa -- ug cu |
|||||||
| Comments |
Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated. |
|||||||
| Genome context |
|
|||||||
| Clustered miRNAs |
|
|||||||
| Database links |
|
|||||||
Mature sequence ggo-miR-183 |
|
| Accession | MIMAT0002787 |
| Sequence |
27 - uauggcacugguagaauucacug - 49 |
| Evidence | by similarity; MI0000273 |
| Predicted targets |
|
References |
|
| 1 |
PMID:15652478
"Phylogenetic shadowing and computational identification of human microRNA genes"
Cell. 120:21-24(2005).
|