Stem-loop sequence mml-mir-19b-2

AccessionMI0003108 (change log)
DescriptionMacaca mulatta miR-19b-2 stem-loop
Gene family MIPF0000011; mir-19
Literature search

3 open access papers mention mml-mir-19b-2
(4 sentences)

Stem-loop
         cuac                 -  -       uuca       u 
5' acauug    uuacaauuaguuuugca gg uuugcau    gcguaua a
   ||||||    ||||||||||||||||| || |||||||    |||||||  
3' uguaau    aguguuagucaaaacgu cc aaacgug    uguauau u
         ----                 a  u       ucgg       g 
Get sequence
Deep sequencing
7231 reads, 22.2 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chrX: 128132026-128132121 [-]
intergenic
Clustered miRNAs
< 10kb from mml-mir-19b-2
mml-mir-106achrX: 128132553-128132633 [-]
mml-mir-18bchrX: 128132396-128132466 [-]
mml-mir-20bchrX: 128132164-128132232 [-]
mml-mir-19b-2chrX: 128132026-128132121 [-]
mml-mir-92a-2chrX: 128131893-128131967 [-]
mml-mir-363chrX: 128131733-128131807 [-]
Database links

Mature sequence mml-miR-19b

Accession MIMAT0002705
Sequence

62 - 

ugugcaaauccaugcaaaacuga

 - 84

Get sequence
Deep sequencing14456 reads, 9 experiments
Evidence by similarity; MI0000075
Database links
Predicted targets

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).