WARNING: This summary was generated by AI. MIR489 is a microRNA implicated in the regulation of muscle satellite cell (MuSC) quiescence and has been identified alongside genes such as CALCR and MIR653 in a specific genomic region [PMC4784275]. It is involved in the maintenance of the quiescent state in MuSCs by repressing the oncogene Dek post-transcriptionally [PMC6303387]. Despite its significant role, MIR489 did not show changes in expression levels after experimental manipulations, suggesting a complex regulatory mechanism [PMC9331933]. Additionally, MIR489 has been linked to cardiac health, where it acts as an antihypertrophic agent by reducing adverse hypertrophy through MyD88 regulation [PMC7123062]. It also serves as a target for the lncRNA cardiac hypertrophy-related factor (chrf), which downregulates MIR489 expression to modulate myocardial hypertrophy [PMC7123062]. In cancer research, overexpression of MIR489 has been observed to downregulate HER2 in breast cancer cell lines, indicating its potential role in cancer biology [PMC4951289]. Furthermore, systematic reviews have correlated downregulation of MIR489 with better prognosis in certain cancers [PMC7827149], highlighting its significance as a biomarker and potential therapeutic target.
c G C C Ua a
guggcag uuggu GUCGUAUGUGUGA G CAUU cuuga c
||||||| ||||| ||||||||||||| | |||| |||||
caucguc aauCG CGGCAUAUACACU C GUGa ggauu c
a A A A -- u
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0002805 |
| Description | Homo sapiens hsa-miR-489-3p mature miRNA |
| Sequence | 52 - GUGACAUCACAUAUACGGCAGC - 73 |
| Evidence |
experimental
array-cloned [1], cloned [2], Illumina [3] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0026605 |
| Description | Homo sapiens hsa-miR-489-5p mature miRNA |
| Sequence | 14 - GGUCGUAUGUGUGACGCCAUUU - 35 |
| Evidence |
experimental
Illumina [3] |
|