Stem-loop sequence hsa-mir-490

Accession MI0003125
Symbol HGNC:MIR490
Description Homo sapiens miR-490 stem-loop
Gene family MIPF0000229; mir-490
Stem-loop 
u     -cc      g    -   aguucauu        c      --         g   caa   u 
 ggagg   uugcug uuug gaa        guucgaca caugga  ucuccaggu ggu   guu a
 |||||   |||||| |||| |||        |||||||| ||||||  ||||||||| |||   |||  
 ccuuc   ggcgac gaac cuu        cgaguugu guaccu  ggaggucca cca   uag g
a     aca      -    a   ------gu        c      ca         a   -cg   a
Get sequence
Deep sequencing
33 reads, 7 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr7: 136587914-136588041 [+]
sense
OTTHUMT00000341010 ; CHRM2-001; intron 2
OTTHUMT00000341012 ; CHRM2-003; intron 2
OTTHUMT00000341013 ; CHRM2-004; intron 2
OTTHUMT00000341016 ; CHRM2-007; intron 2
OTTHUMT00000341010 ; CHRM2-001; intron 2
OTTHUMT00000341012 ; CHRM2-003; intron 2
OTTHUMT00000341013 ; CHRM2-004; intron 2
OTTHUMT00000341016 ; CHRM2-007; intron 2
OTTHUMT00000341010 ; CHRM2-001; intron 2
OTTHUMT00000341016 ; CHRM2-007; intron 2
OTTHUMT00000341013 ; CHRM2-004; intron 2
OTTHUMT00000341012 ; CHRM2-003; intron 2
ENST00000445907 ; CHRM2-001; intron 2
ENST00000453373 ; CHRM2-004; intron 2
ENST00000320658 ; CHRM2-007; intron 2
ENST00000401861 ; CHRM2-003; intron 2
ENST00000397608 ; CHRM2-201; intron 2
ENST00000402486 ; CHRM2-202; intron 2
ENST00000445907 ; CHRM2-001; intron 2
ENST00000453373 ; CHRM2-004; intron 2
ENST00000320658 ; CHRM2-007; intron 2
ENST00000401861 ; CHRM2-003; intron 2
ENST00000397608 ; CHRM2-201; intron 2
ENST00000402486 ; CHRM2-202; intron 2
ENST00000445907 ; CHRM2-001; intron 2
ENST00000320658 ; CHRM2-007; intron 2
ENST00000453373 ; CHRM2-004; intron 2
ENST00000401861 ; CHRM2-003; intron 2
ENST00000397608 ; CHRM2-201; intron 2
ENST00000402486 ; CHRM2-202; intron 2
antisense
OTTHUMT00000341009 ; AC009264.1-002; intron 2
OTTHUMT00000341009 ; AC009264.1-002; intron 2
OTTHUMT00000341009 ; AC009264.1-002; intron 2
OTTHUMT00000341008 ; AC009264.1-001; intron 3
OTTHUMT00000341008 ; AC009264.1-001; intron 3
OTTHUMT00000341008 ; AC009264.1-001; intron 3
ENST00000425981 ; AC009264.1-002; intron 2
ENST00000425981 ; AC009264.1-002; intron 2
ENST00000425981 ; AC009264.1-002; intron 2
ENST00000439694 ; AC009264.1-001; intron 3
ENST00000439694 ; AC009264.1-001; intron 3
ENST00000439694 ; AC009264.1-001; intron 3
Database links

Mature sequence hsa-miR-490-5p

Accession MIMAT0004764
Sequence

39 -  

ccauggaucuccaggugggu

 - 58

Get sequence
Deep sequencing 25 reads, 4 experiments
Evidence experimental; cloned [2-3]
Predicted targets

Mature sequence hsa-miR-490-3p

Accession MIMAT0002806
Previous IDs hsa-miR-490
Sequence

76 -  

caaccuggaggacuccaugcug

 - 97

Get sequence
Deep sequencing 8 reads, 4 experiments
Evidence experimental; array-cloned [1]
Predicted targets

References

1
PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:18230126 "New miRNAs cloned from neuroblastoma" Afanasyeva EA, Hotz-Wagenblatt A, Glatting KH, Westermann F BMC Genomics. 9:52(2008).