WARNING: This summary was generated by AI. MIR511 is a microRNA implicated in various biological processes and diseases, including hepatocellular carcinoma (HCC) [PMC8369952]. It is classified under a group of microRNAs that are expressed in the alimentary system and are responsive to stimuli [PMC8369952]. MIR511, along with Mir455, has been observed to be downregulated in a rat model of diethylnitrosamine (DEN) chemically induced HCC, suggesting its potential role in the pathogenesis of this cancer [PMC8369952]. The interactions between MIR511 and the pseudogene Adh6-ps1 are of particular interest as they may contribute to the understanding of HCC; Adh6-ps1 has been found to be moderately expressed in HCC, and its association with MIR511 could indicate a regulatory role in tumorigenesis [PMC8369952]. Despite challenges in predicting targets for new microRNAs such as MIR511 due to limited sequence data [PMC2394755], studies have shown that MIR511 can enhance Bax expression, thereby inhibiting the growth of radiation-resistant A549 cells and suggesting its involvement in apoptosis mechanisms [PMC6525830].
a ac CG C G g ua
caau gac ccau UGUCUUUUGCU UGCA UCA uaaa u
|||| ||| |||| ||||||||||| |||| ||| ||||
guua cug ggUA ACAGAAAACGA GUGU Agu guuu u
c gu AG U A - uu
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0002808 |
| Description | Homo sapiens hsa-miR-511-5p mature miRNA |
| Sequence | 15 - CGUGUCUUUUGCUCUGCAGUCA - 36 |
| Evidence |
experimental
array-cloned [1], Illumina [2] |
| Accession | MIMAT0026606 |
| Description | Homo sapiens hsa-miR-511-3p mature miRNA |
| Sequence | 54 - AAUGUGUAGCAAAAGACAGAAU - 75 |
| Evidence |
experimental
Illumina [2] |
| Database links |
|
| Predicted targets |
|
|