Stem-loop sequence hsa-mir-493

Accession MI0003132
Symbol HGNC:MIR493
Description Homo sapiens miR-493 stem-loop
Gene family MIPF0000230; mir-493
Stem-loop 
     cuc        u                    cauuc  u 
cuggc   cagggcuu guacaugguaggcuuucauu     gu u
|||||   |||||||| ||||||||||||||||||||     ||  
gaccg   gucccgga cgugugucaucuggaagugg     ca g
     --u        c                    -cuua  c
Get sequence
Deep sequencing
447 reads, 10 experiments
Comments

The mature miRNA sequences were named miR-493-5p and miR-493-3p in [1,2] and here. Landgraf et al. showed that the 3' product is the predominant one [3]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr14: 101335397-101335485 [+]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-493
hsa-mir-493 chr14: 101335397-101335485 [+]
hsa-mir-337 chr14: 101340830-101340922 [+]
hsa-mir-665 chr14: 101341370-101341441 [+]
Database links

Mature sequence hsa-miR-493-5p

Accession MIMAT0002813
Previous IDs hsa-miR-493;hsa-miR-493-5p;hsa-miR-493*
Sequence

16 -  

uuguacaugguaggcuuucauu

 - 37

Get sequence
Deep sequencing 347 reads, 2 experiments
Evidence experimental; array-cloned [1], cloned [2-3]
Predicted targets

Mature sequence hsa-miR-493-3p

Accession MIMAT0003161
Previous IDs hsa-miR-493-3p;hsa-miR-493
Sequence

57 -  

ugaaggucuacugugugccagg

 - 78

Get sequence
Deep sequencing 100 reads, 9 experiments
Evidence experimental; cloned [2-3]
Predicted targets

References

1
PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
2
PMID:16274478 "Identification of clustered microRNAs using an ab initio prediction method" Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M BMC Bioinformatics. 6:267(2005).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).