![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-432 |
||||||||||||||||
Accession | MI0003133 (change log) | |||||||||||||||
Symbol | HGNC:MIR432 | |||||||||||||||
Description | Homo sapiens miR-432 stem-loop | |||||||||||||||
Gene family | MIPF0000211; mir-432 | |||||||||||||||
Literature search |
![]()
42 open access papers mention hsa-mir-432 | |||||||||||||||
Stem-loop |
u - c u u ua g a u - uu 5' ga cu cuccagg c uggag ggucauu ggugg ucc c ua u || || ||||||| | ||||| ||||||| ||||| ||| | || 3' cu ga gagguuc g accuc ucgguag ucacc ggg g au c a a u u u -c g - u c uc |
|||||||||||||||
Deep sequencing |
| |||||||||||||||
Confidence |
Annotation confidence: not enough data
| |||||||||||||||
Genome context |
|
|||||||||||||||
Clustered miRNAs |
|
|||||||||||||||
Database links |
|
Mature sequence hsa-miR-432-5p |
|
Accession | MIMAT0002814 |
Previous IDs | hsa-miR-432 |
Sequence |
14 - ucuuggaguaggucauugggugg - 36 |
Deep sequencing | 28093 reads, 128 experiments |
Evidence | experimental; array-cloned [1], cloned [2-3] |
Database links |
|
Predicted targets |
|
Mature sequence hsa-miR-432-3p |
|
Accession | MIMAT0002815 |
Previous IDs | hsa-miR-432* |
Sequence |
62 - cuggauggcuccuccaugucu - 82 |
Deep sequencing | 47 reads, 34 experiments |
Evidence | experimental; array-cloned [1] |
Predicted targets |
|
References |
|
1 |
PMID:15965474
"Identification of hundreds of conserved and nonconserved human microRNAs"
Nat Genet. 37:766-770(2005).
|
2 |
PMID:16274478
"Identification of clustered microRNAs using an ab initio prediction method"
BMC Bioinformatics. 6:267(2005).
|
3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|