miRBase entry: hsa-mir-495

Stem-loop hsa-mir-495


Accession
MI0003135
Symbol
HGNC: MIR495
Description
Homo sapiens hsa-mir-495 precursor miRNA mir-329
Gene
family?
RF04295; mir-329

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR495 is a microRNA implicated in various biological processes, including tumorigenesis and metastasis, and has been identified as a potential player in uveal melanoma (UM) [PMC2902045]. In a study, the combination of MIR495 and doxorubicin (DOX) encapsulated in cell-penetrating carrier molecules (CCM) with surface ligand integration (SLI) and redox-responsive disassembly (R-D) demonstrated significantly enhanced therapeutic efficacy against cancer, with tumor volume reduction [PMC6841775]. MIR495 has also been observed to be overexpressed in the RTT-mouse model, where it is known to repress the expression of Bdnf [PMC8595945]. In lung cancer research focusing on multidrug resistance (MDR), MIR495's role was investigated concerning the regulation of P-glycoprotein (P-gp), a critical factor in drug resistance mechanisms [PMC6841775]. The study utilized MIR495 supplied by Cell Biolabs Inc. to examine its interaction with SLI through gel retardation assays, comparing it against uncoated MIR495 as a control [PMC6841775]. The methodology for coating CCM onto SLI/R-D was analogous to that used for binding MIR495, ensuring consistency in experimental procedures [PMC6841775].

Literature search
50 open access papers mention hsa-mir-495
(177 sentences)

Sequence

10128 reads, 41 reads per million, 102 experiments
ugguaccugaaaaGAAGUUGCCCAUGUUAUUUUCGcuuuauaugugacgAAACAAACAUGGUGCACUUCUUuuucgguauca
(((((((.((((((((((.(((((((((..((((((.........).)))))..))))))).)))))))))))).)))))))

Structure
       u          U  -       AU     - uuu 
ugguacc gaaaaGAAGU GC CCAUGUU  UUUCG c   a
||||||| |||||||||| || |||||||  ||||| |   u
acuaugg uuuUUCUUCA CG GGUACAA  AAAgc g   a
       c          -  U       AC     a ugu 


Annotation confidence Medium
Do you think this miRNA is real?

Genome context
chr14: 101033755-101033836 [+]
Clustered miRNAs
17 other miRNAs are < 10 kb from hsa-mir-495
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-495 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-495-3p

Accession MIMAT0002817
Description Homo sapiens hsa-miR-495-3p mature miRNA
Sequence 50 - AAACAAACAUGGUGCACUUCUU - 71
Evidence experimental
array-cloned [1], cloned [2], SOLiD [3]
Database links
Predicted targets

Mature hsa-miR-495-5p

Accession MIMAT0022924
Description Homo sapiens hsa-miR-495-5p mature miRNA
Sequence 14 - GAAGUUGCCCAUGUUAUUUUCG - 35
Evidence experimental
SOLiD [3]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 15965474
    Identification of hundreds of conserved and nonconserved human microRNAs
    "Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z"
    "Nat Genet (2005) 37:766-770

  3. PubMed ID: 22282338
    Deep-sequencing of endothelial cells exposed to hypoxia reveals the complexity of known and novel microRNAs
    "Voellenkle C, Rooij Jv, Guffanti A, Brini E, Fasanaro P, Isaia E, Croft L, David M, Capogrossi MC, Moles A, Felsani A, Martelli F"
    "RNA (2012) 18:472-484