Stem-loop sequence hsa-mir-496

AccessionMI0003136 (change log)
Symbol HGNC:MIR496
DescriptionHomo sapiens miR-496 stem-loop
Gene family MIPF0000018; mir-154
Literature search

15 open access papers mention hsa-mir-496
(117 sentences)

Stem-loop 
         -----uca     u    u        u     gu         uua 
5' cccaag        gguac cgaa ggagguug ccaug  guguucauu   u
   ||||||        ||||| |||| |||||||| |||||  |||||||||    
3' ggguuc        ucaug gcuu ccucuaac gguac  uaugaguag   u
         uucuuaac     -    u        c     au         uau
Get sequence
Deep sequencing
704 reads, 0 reads per million, 92 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 5' end of the miRNA may be offset with respect to previous annotations. miR-496 cloned in [2] has a 1 nt 3' extension (U), which is incompatible with the genome sequence.

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr14: 101060573-101060674 [+]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-496
hsa-mir-487achr14: 101052446-101052525 [+]
hsa-mir-382chr14: 101054306-101054381 [+]
hsa-mir-134chr14: 101054687-101054759 [+]
hsa-mir-668chr14: 101055258-101055323 [+]
hsa-mir-485chr14: 101055419-101055491 [+]
hsa-mir-323bchr14: 101056219-101056300 [+]
hsa-mir-154chr14: 101059755-101059838 [+]
hsa-mir-496chr14: 101060573-101060674 [+]
hsa-mir-377chr14: 101062050-101062118 [+]
hsa-mir-541chr14: 101064495-101064578 [+]
hsa-mir-409chr14: 101065300-101065378 [+]
hsa-mir-412chr14: 101065447-101065537 [+]
hsa-mir-369chr14: 101065598-101065667 [+]
hsa-mir-410chr14: 101065912-101065991 [+]
hsa-mir-656chr14: 101066724-101066801 [+]
Database links

Mature sequence hsa-miR-496

Accession MIMAT0002818
Sequence

56 -  

ugaguauuacauggccaaucuc

 - 77

Get sequence
Deep sequencing423 reads, 85 experiments
Evidence experimental; array-cloned [1], cloned [2]
Database links
Predicted targets

References

1
PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).