![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-496 |
||||||||||||||||||||||||||||||||
Accession | MI0003136 (change log) | |||||||||||||||||||||||||||||||
Symbol | HGNC:MIR496 | |||||||||||||||||||||||||||||||
Description | Homo sapiens miR-496 stem-loop | |||||||||||||||||||||||||||||||
Gene family | MIPF0000018; mir-154 | |||||||||||||||||||||||||||||||
Literature search |
![]()
15 open access papers mention hsa-mir-496 | |||||||||||||||||||||||||||||||
Stem-loop |
-----uca u u u gu uua 5' cccaag gguac cgaa ggagguug ccaug guguucauu u |||||| ||||| |||| |||||||| ||||| ||||||||| 3' ggguuc ucaug gcuu ccucuaac gguac uaugaguag u uucuuaac - u c au uau |
|||||||||||||||||||||||||||||||
Deep sequencing |
| |||||||||||||||||||||||||||||||
Confidence |
Annotation confidence: not enough data
| |||||||||||||||||||||||||||||||
Comments |
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 5' end of the miRNA may be offset with respect to previous annotations. miR-496 cloned in [2] has a 1 nt 3' extension (U), which is incompatible with the genome sequence. |
|||||||||||||||||||||||||||||||
Genome context |
|
|||||||||||||||||||||||||||||||
Clustered miRNAs |
|
|||||||||||||||||||||||||||||||
Database links |
|
Mature sequence hsa-miR-496 |
|
Accession | MIMAT0002818 |
Sequence |
56 - ugaguauuacauggccaaucuc - 77 |
Deep sequencing | 423 reads, 85 experiments |
Evidence | experimental; array-cloned [1], cloned [2] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:15965474
"Identification of hundreds of conserved and nonconserved human microRNAs"
Nat Genet. 37:766-770(2005).
|
2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|