MIR193B is identified as a tumor suppressor in the hematopoietic system, with a significant role in the regulation of cell cycle and apoptosis in Acute Myelocytic Leukemia (AML) [PMC7273449]. It has been shown to induce apoptosis and cause G1/S-phase cell cycle arrest across various AML subtypes, suggesting its potential as a therapeutic target [PMC7273449]. The genetic locus of MIR193B is within the MIR193B host gene (MIR193BHG) on chromosome 16 of the human genome, as per the GRCh38/hg38 assembly available on the UCSC Genome Browser [PMC9779864]. This locus is also characterized by its high sequence conservation across different species, indicating its evolutionary importance and potential functional significance [PMC9779864].
u G A A uua
guggucucagaa CGGGGUUUUGAGGGC AG UG gu u
|||||||||||| ||||||||||||||| || || || g
uacugggguuuU GCCCUGAAACUCCCG UC Ac ua u
C G A c uuu
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0004767 |
| Description | Homo sapiens hsa-miR-193b-5p mature miRNA |
| Sequence | 14 - CGGGGUUUUGAGGGCGAGAUGA - 35 |
| Evidence |
experimental
cloned [3-4] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0002819 |
| Description | Homo sapiens hsa-miR-193b-3p mature miRNA |
| Sequence | 51 - AACUGGCCCUCAAAGUCCCGCU - 72 |
| Evidence |
experimental
array-cloned [1], cloned [2-4] |
| Database links |
|
| Predicted targets |
|
|