Stem-loop sequence hsa-mir-519e

Accession

MI0003145 (change log)

Symbol

HGNC:MIR519E

Description

Homo sapiens miR-519e stem-loop

Gene family

MIPF0000020; mir-515

Literature search

24 open access papers mention hsa-mir-519e
(62 sentences)

Stem-loop

        u     c  u   c      ga      uc     ga 
5' ucuca gcagu au cuc aaaagg  gcacuu  uguuu  a
   ||||| ||||| || ||| ||||||  ||||||  |||||   
3' agagu uguca ug gag uuuucc  cgugaa  acaaa  a
        u     u  u   a      uc      --     ag 

Deep sequencing

3616 reads, 10.2 reads per million, 49 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr19: 53679940-53680023 [+]
• Overlapping transcripts:

  antisense

  OTTHUMT00000464179 ; ZNF665-002; intron 1

  OTTHUMT00000464180 ; ZNF665-001; intron 2

  ENST00000600412 ; ZNF665-002; intron 1

  ENST00000396424 ; ZNF665-001; intron 2

Clustered miRNAs

< 10kb from hsa-mir-519e

• hsa-mir-1323: chr19: 53671968-53672040 [+]
• hsa-mir-498: chr19: 53674197-53674320 [+]
• hsa-mir-520e: chr19: 53675711-53675797 [+]
• hsa-mir-515-1: chr19: 53679003-53679085 [+]
• hsa-mir-519e: chr19: 53679940-53680023 [+]
• hsa-mir-520f: chr19: 53682159-53682245 [+]
• hsa-mir-515-2: chr19: 53685009-53685091 [+]
• hsa-mir-519c: chr19: 53686469-53686555 [+]
• hsa-mir-1283-1: chr19: 53688481-53688567 [+]

Database links

• EntrezGene:MIR519E
• HGNC:MIR519E
• miRBase Tracker:MI0003145

Mature sequence hsa-miR-519e-5p

• Accession: MIMAT0002828
• Previous IDs: hsa-miR-519e*
• Sequence: 14 - uucuccaaaagggagcacuuuc - 35
• Deep sequencing: 9 reads, 6 experiments
• Evidence: experimental; array-cloned [1]
• Predicted targets:
  • TargetMiner:hsa-miR-519e-5p
  • TargetScanVert:hsa-miR-519e-5p
  • miRDB:hsa-miR-519e-5p
  • microrna.org:hsa-miR-519e-5p

Mature sequence hsa-miR-519e-3p

• Accession: MIMAT0002829
• Previous IDs: hsa-miR-519e
• Sequence: 52 - aagugccuccuuuuagaguguu - 73
• Deep sequencing: 3602 reads, 47 experiments
• Evidence: experimental; array-cloned [1], cloned [2]
• Predicted targets:
  • TargetMiner:hsa-miR-519e-3p
  • TargetScanVert:hsa-miR-519e-3p
  • miRDB:hsa-miR-519e-3p
  • microrna.org:hsa-miR-519e-3p

References

1. PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
2. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).