|
miRBase |
|
Stem-loop sequence hsa-mir-519b |
|||||
| Accession | MI0003151 | ||||
| Symbol | HGNC:MIR519B | ||||
| Description | Homo sapiens miR-519b stem-loop | ||||
| Gene family | MIPF0000020; mir-515 | ||||
| Stem-loop |
u u c a guug u ca gc guga ccucuagaggga gcgcuuucu uc g || || |||| |||||||||||| ||||||||| || a gu ug cauu ggagauuuuccu cgugaaaga ag a u u u a --aa a |
||||
| Deep sequencing |
| ||||
| Comments |
The 5' arm of this precursor expresses a product related to miR-526 (previously named miR-526c here). Landgraf et al. confirm mature miRNA expression from both arms of the precursor [2], leading to the -5p, -3p designations. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. |
||||
| Genome context |
|
||||
| Clustered miRNAs | |||||
| Database links | |||||
Mature sequence hsa-miR-519b-5p |
|
| Accession | MIMAT0005454 |
| Sequence |
13 - cucuagagggaagcgcuuucug - 34 |
| Deep sequencing | 8 reads, 2 experiments |
| Evidence | experimental; array-cloned [1], cloned [2] |
| Predicted targets |
|
Mature sequence hsa-miR-519b-3p |
|
| Accession | MIMAT0002837 |
| Previous IDs | hsa-miR-519b |
| Sequence |
51 - aaagugcauccuuuuagagguu - 72 |
| Deep sequencing | 13 reads, 3 experiments |
| Evidence | experimental; array-cloned [1], cloned [2] |
| Validated targets |
|
| Predicted targets |
|
References |
|
| 1 |
PMID:15965474
"Identification of hundreds of conserved and nonconserved human microRNAs"
Nat Genet. 37:766-770(2005).
|
| 2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|