Stem-loop sequence hsa-mir-525

AccessionMI0003152 (change log)
Symbol HGNC:MIR525
DescriptionHomo sapiens miR-525 stem-loop
Gene family MIPF0000020; mir-515
Literature search

10 open access papers mention hsa-mir-525
(76 sentences)

Stem-loop 
                u   c       u  a      c  aug 
5' cucaagcugugac cuc agaggga gc cuuucu uu   u
   ||||||||||||| ||| ||||||| || |||||| ||   g
3' ggguuuggcauug gag uuucccu cg ggaaga aa   a
                c   a       u  c      a  aaa
Get sequence
Deep sequencing
113 reads, 8.16 reads per million, 49 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

The mature products were previously named miR-525 and miR-525* in [1] and here. Landgraf et al. show that both products are significantly expressed, prompting a renaming to miR-525-5p and miR-525-3p [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr19: 53697533-53697617 [+]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-525
hsa-mir-1283-1chr19: 53688481-53688567 [+]
hsa-mir-520achr19: 53690881-53690965 [+]
hsa-mir-526bchr19: 53694393-53694475 [+]
hsa-mir-519bchr19: 53695213-53695293 [+]
hsa-mir-525chr19: 53697533-53697617 [+]
hsa-mir-523chr19: 53698385-53698471 [+]
hsa-mir-518fchr19: 53700015-53700101 [+]
hsa-mir-520bchr19: 53701227-53701287 [+]
hsa-mir-518bchr19: 53702737-53702819 [+]
hsa-mir-526a-1chr19: 53706252-53706336 [+]
hsa-mir-520cchr19: 53707453-53707539 [+]
Database links

Mature sequence hsa-miR-525-5p

Accession MIMAT0002838
Previous IDshsa-miR-525
Sequence

15 -  

cuccagagggaugcacuuucu

 - 35

Get sequence
Deep sequencing73 reads, 37 experiments
Evidence experimental; array-cloned [1], cloned [2]
Predicted targets

Mature sequence hsa-miR-525-3p

Accession MIMAT0002839
Previous IDshsa-miR-525*
Sequence

52 -  

gaaggcgcuucccuuuagagcg

 - 73

Get sequence
Deep sequencing29 reads, 12 experiments
Evidence experimental; array-cloned [1], cloned [2]
Predicted targets

References

1
PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).