MIR524 is a microRNA gene that is part of the C19MC miRNA cluster, which includes a total of 46 miRNA genes [PMC6193703]. This gene plays a significant role in the regulation of various pathways, as its downregulation has been associated with the activation of the TGF-β, Notch, and Hippo pathways due to an overexpressed EGFR/myc axis in breast invasive carcinoma [PMC9966483]. Additionally, MIR524 has been identified as a regulator of MXD1 and is influenced by copy number variations (CNVs) along with other microRNAs such as mir1283 and mir520d [PMC3938728]. In liver hepatocellular carcinoma (LIHC), MIR524 expression was analyzed as part of an integrated dataset that combined miRNA-seq and RNA-seq data to provide insights into its role in cancer [PMC7378193]. Furthermore, EGFR has been shown to negatively regulate MIR524 by recruiting repressive histone modifiers to its promoter region, which results in reduced production of pri-miR-524 [PMC7766154].
                                 u        c  A           A      Cuug   a 
ucuca gcugugac CU CAAAGGGAAGC CUUUCU    ucc  
||||| |||||||| || ||||||||||| ||||||    ||| a
agagu uggcauug GA GUUUCCCUUCG GGAAGa    agg  
     u        U  G           C      --aa   a 
            | Name | Accession | Chromosome | Start | End | Strand | Confidence | 
|---|
| Disease | Description | Category | PubMed ID | 
|---|
| Accession | MIMAT0002849 | 
| Description | Homo sapiens hsa-miR-524-5p mature miRNA | 
| Sequence | 16 - CUACAAAGGGAAGCACUUUCUC - 37 | 
| Evidence | 
                                    experimental
                                    
                                     array-cloned [1], cloned [2]  | 
                            
| Database links | 
                                    
                                                
                                                     
                                 
                                       
                                        
                                           
                                          
                                           
                                        
                                           
                                          
                                           
                                       
                                   
                                 | 
| Predicted targets | 
                                        
                                          
                                            
                                                
                                                     
                                                
                                            
                                            
                                           
                                          
                                           
                                          
                                            
                                                
                                                     
                                                
                                            
                                            
                                           
                                          
                                            
                                                
                                                     
                                                
                                            
                                            
                                           
                                          
                                         
                                        
                                
                                        
                                
                                        
                                     | 
                                
| Accession | MIMAT0002850 | 
| Description | Homo sapiens hsa-miR-524-3p mature miRNA | 
| Sequence | 53 - GAAGGCGCUUCCCUUUGGAGU - 73 | 
| Evidence | 
                                    experimental
                                    
                                     array-cloned [1]  | 
                            
                        
  |