![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-517a |
||||||||||||||||||||||||
Accession | MI0003161 (change log) | |||||||||||||||||||||||
Symbol | HGNC:MIR517A | |||||||||||||||||||||||
Description | Homo sapiens miR-517a stem-loop | |||||||||||||||||||||||
Gene family | MIPF0000020; mir-515 | |||||||||||||||||||||||
Literature search |
![]()
33 open access papers mention hsa-mir-517a | |||||||||||||||||||||||
Stem-loop |
c u a u g g a 5' ucucaggcagugac cucuaga gga gcac gucu uu u u |||||||||||||| ||||||| ||| |||| |||| || | a 3' agaguuugucauug gagauuu ccu cgug uaga aa a a u c a c a g a |
|||||||||||||||||||||||
Deep sequencing |
| |||||||||||||||||||||||
Confidence |
Annotation confidence: not enough data
| |||||||||||||||||||||||
Comments |
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. |
|||||||||||||||||||||||
Genome context |
|
|||||||||||||||||||||||
Clustered miRNAs |
|
|||||||||||||||||||||||
Database links |
|
Mature sequence hsa-miR-517-5p |
|
Accession | MIMAT0002851 |
Previous IDs | hsa-miR-517* |
Sequence |
15 - ccucuagauggaagcacugucu - 36 |
Deep sequencing | 45 reads, 11 experiments |
Evidence | experimental; array-cloned [1] |
Predicted targets |
|
Mature sequence hsa-miR-517a-3p |
|
Accession | MIMAT0002852 |
Previous IDs | hsa-miR-517a |
Sequence |
54 - aucgugcaucccuuuagagugu - 75 |
Deep sequencing | 479 reads, 70 experiments |
Evidence | experimental; array-cloned [1], cloned [2] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:15965474
"Identification of hundreds of conserved and nonconserved human microRNAs"
Nat Genet. 37:766-770(2005).
|
2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|