Stem-loop sequence hsa-mir-517a

AccessionMI0003161 (change log)
Symbol HGNC:MIR517A
DescriptionHomo sapiens miR-517a stem-loop
Gene family MIPF0000020; mir-515
Literature search

33 open access papers mention hsa-mir-517a
(188 sentences)

Stem-loop 
                 c       u   a    u    g  g a 
5' ucucaggcagugac cucuaga gga gcac gucu uu u u
   |||||||||||||| ||||||| ||| |||| |||| || | a
3' agaguuugucauug gagauuu ccu cgug uaga aa a a
                 u       c   a    c    a  g a
Get sequence
Deep sequencing
500 reads, 1.32 reads per million, 76 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr19: 53712268-53712354 [+]
sense
OTTHUMT00000464185 ; CTD-2245F17.3-001; intron 4
ENST00000597550 ; CTD-2245F17.3-001; intron 4
Clustered miRNAs
< 10kb from hsa-mir-517a
hsa-mir-518bchr19: 53702737-53702819 [+]
hsa-mir-526a-1chr19: 53706252-53706336 [+]
hsa-mir-520cchr19: 53707453-53707539 [+]
hsa-mir-518cchr19: 53708735-53708835 [+]
hsa-mir-524chr19: 53711002-53711088 [+]
hsa-mir-517achr19: 53712268-53712354 [+]
hsa-mir-519dchr19: 53713347-53713434 [+]
hsa-mir-521-2chr19: 53716594-53716680 [+]
hsa-mir-520dchr19: 53720096-53720182 [+]
hsa-mir-517bchr19: 53721076-53721142 [+]
hsa-mir-520gchr19: 53722166-53722255 [+]
Database links

Mature sequence hsa-miR-517-5p

Accession MIMAT0002851
Previous IDshsa-miR-517*
Sequence

15 -  

ccucuagauggaagcacugucu

 - 36

Get sequence
Deep sequencing45 reads, 11 experiments
Evidence experimental; array-cloned [1]
Predicted targets

Mature sequence hsa-miR-517a-3p

Accession MIMAT0002852
Previous IDshsa-miR-517a
Sequence

54 -  

aucgugcaucccuuuagagugu

 - 75

Get sequence
Deep sequencing479 reads, 70 experiments
Evidence experimental; array-cloned [1], cloned [2]
Database links
Predicted targets

References

1
PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).