Stem-loop sequence hsa-mir-520d

AccessionMI0003164 (change log)
Symbol HGNC:MIR520D
DescriptionHomo sapiens miR-520d stem-loop
Gene family MIPF0000020; mir-515
Literature search

54 open access papers mention hsa-mir-520d
(187 sentences)

Stem-loop 
                g  ua           c      guug  u 
5' ucucaagcuguga uc  caaagggaagc cuuucu    uc a
   ||||||||||||| ||  ||||||||||| ||||||    || a
3' agaguuuggcauu gg  guuucucuucg gaaaga    ag a
                g  ug           u      --aa  a
Get sequence
Deep sequencing
155 reads, 0 reads per million, 42 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

The mature products were previously named miR-520d and miR-520d* here and in [1]. Landgraf et al. show that both products may be significantly expressed [2]. They are therefore renamed miR-520d-5p and miR-520d-3p. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr19: 53720096-53720182 [+]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-520d
hsa-mir-524chr19: 53711002-53711088 [+]
hsa-mir-517achr19: 53712268-53712354 [+]
hsa-mir-519dchr19: 53713347-53713434 [+]
hsa-mir-521-2chr19: 53716594-53716680 [+]
hsa-mir-520dchr19: 53720096-53720182 [+]
hsa-mir-517bchr19: 53721076-53721142 [+]
hsa-mir-520gchr19: 53722166-53722255 [+]
hsa-mir-516b-2chr19: 53725442-53725526 [+]
hsa-mir-526a-2chr19: 53726922-53726986 [+]
hsa-mir-518echr19: 53729838-53729925 [+]
Database links

Mature sequence hsa-miR-520d-5p

Accession MIMAT0002855
Previous IDshsa-miR-520d*
Sequence

16 -  

cuacaaagggaagcccuuuc

 - 35

Get sequence
Deep sequencing90 reads, 25 experiments
Evidence experimental; array-cloned [1], cloned [2]
Predicted targets

Mature sequence hsa-miR-520d-3p

Accession MIMAT0002856
Previous IDshsa-miR-520d
Sequence

54 -  

aaagugcuucucuuuggugggu

 - 75

Get sequence
Deep sequencing58 reads, 26 experiments
Evidence experimental; array-cloned [1], cloned [2]
Predicted targets

References

1
PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).