WARNING: This summary was generated by AI. MIR502 is a microRNA that has been studied for its role in cellular processes, particularly in the context of the cell cycle in PaTuT cells, as evidenced by flow cytometry analysis [PMC7002776]. The impact of MIR502 on cell cycle regulation suggests that it may play a significant role in cellular proliferation and differentiation within these specific tissues where it is prominently expressed [PMC7002776].
u - UAU UAg ugg gcucccccucucu aAUCCUUGC CUGGGUGC ugc c ||||||||||||| ||||||||| |||||||| ||| u cgagggggagagA UUAGGAACG GGUCCACG Acg c u C --- -UA uaa
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0002873 |
| Description | Homo sapiens hsa-miR-502-5p mature miRNA |
| Sequence | 16 - AUCCUUGCUAUCUGGGUGCUA - 36 |
| Evidence |
experimental
array-cloned [1] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0004775 |
| Description | Homo sapiens hsa-miR-502-3p mature miRNA |
| Sequence | 52 - AAUGCACCUGGGCAAGGAUUCA - 73 |
| Evidence |
experimental
cloned [2] |
| Database links |
|
| Predicted targets |
|
|