![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-450a-2 |
||||||||||||||
Accession | MI0003187 (change log) | |||||||||||||
Previous IDs | hsa-mir-450-2 | |||||||||||||
Symbol | HGNC:MIR450A2 | |||||||||||||
Description | Homo sapiens miR-450a-2 stem-loop | |||||||||||||
Gene family | MIPF0000128; mir-450 | |||||||||||||
Literature search |
![]()
21 open access papers mention hsa-mir-450a-2 | |||||||||||||
Stem-loop |
-ccaaagaaa u uuu u aa 5' gaugc aaacuau ugcga guguuccuaauaugu u ||||| ||||||| ||||| ||||||||||||||| a 3' cuaug uuugaua acguu uacagggguuaugua u gguauaauaa u cuu u aa |
|||||||||||||
Deep sequencing |
| |||||||||||||
Confidence |
Annotation confidence: high
| |||||||||||||
Genome context |
|
|||||||||||||
Clustered miRNAs |
|
|||||||||||||
Database links |
|
Mature sequence hsa-miR-450a-5p |
|
Accession | MIMAT0001545 |
Previous IDs | hsa-miR-450;hsa-miR-450a |
Sequence |
23 - uuuugcgauguguuccuaauau - 44 |
Deep sequencing | 98394 reads, 157 experiments |
Evidence | experimental; array-cloned [1,3], cloned [1,4] |
Database links |
|
Predicted targets |
|
Mature sequence hsa-miR-450a-2-3p |
|
Accession | MIMAT0031074 |
Sequence |
58 - auuggggacauuuugcauucau - 79 |
Deep sequencing | 2622 reads, 112 experiments |
Evidence | not experimental |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:15735639
"Systematic discovery of regulatory motifs in human promoters and 3' UTRs by comparison of several mammals"
Nature. 434:338-345(2005).
|
2 |
PMID:15965474
"Identification of hundreds of conserved and nonconserved human microRNAs"
Nat Genet. 37:766-770(2005).
|
3 |
PMID:16274478
"Identification of clustered microRNAs using an ab initio prediction method"
BMC Bioinformatics. 6:267(2005).
|
4 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|