![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-503 |
||||||||||||||
Accession | MI0003188 (change log) | |||||||||||||
Symbol | HGNC:MIR503 | |||||||||||||
Description | Homo sapiens miR-503 stem-loop | |||||||||||||
Gene family | MIPF0000183; mir-503 | |||||||||||||
Literature search |
![]()
113 open access papers mention hsa-mir-503 | |||||||||||||
Stem-loop |
a u g gu a 5' ugcccu gcagcgggaacagu cu ca gagcg u |||||| |||||||||||||| || || ||||| c 3' auggga cgucgccuuuguua gg gu cucgu g c u g -- g |
|||||||||||||
Deep sequencing |
| |||||||||||||
Confidence |
Annotation confidence: high
| |||||||||||||
Genome context |
|
|||||||||||||
Clustered miRNAs |
|
|||||||||||||
Database links |
|
Mature sequence hsa-miR-503-5p |
|
Accession | MIMAT0002874 |
Previous IDs | hsa-miR-503 |
Sequence |
6 - uagcagcgggaacaguucugcag - 28 |
Deep sequencing | 59540 reads, 156 experiments |
Evidence | experimental; array-cloned [1], cloned [2-3], SOLiD [4] |
Database links |
|
Predicted targets |
|
Mature sequence hsa-miR-503-3p |
|
Accession | MIMAT0022925 |
Sequence |
46 - gggguauuguuuccgcugccagg - 68 |
Deep sequencing | 1196 reads, 48 experiments |
Evidence | experimental; SOLiD [4] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:15965474
"Identification of hundreds of conserved and nonconserved human microRNAs"
Nat Genet. 37:766-770(2005).
|
2 |
PMID:16274478
"Identification of clustered microRNAs using an ab initio prediction method"
BMC Bioinformatics. 6:267(2005).
|
3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
4 |