Stem-loop sequence hsa-mir-513a-1

Accession MI0003191
Previous IDs hsa-mir-513-1
Symbol HGNC:MIR513A1
Description Homo sapiens miR-513a-1 stem-loop
Gene family MIPF0000130; mir-506
Stem-loop
            uca  cauu  -  -     g        a   gg     uc        gaa 
gggaugccacau   gc    ca gc guaca ugccuuuc cag  aggug  auuuaugu   c
||||||||||||   ||    || || ||||| |||||||| |||  |||||  ||||||||    
cccuguggugua   cg    gu cg caugu augggaag guc  uccac  uaaauaua   u
            -ua  ucac  a  a     a        a   uu     uu        aaa 
Get sequence
Deep sequencing
1644 reads, 12 experiments
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chrX: 146294981-146295109 [-]
intergenic
Database links

Mature sequence hsa-miR-513a-5p

Accession MIMAT0002877
Previous IDs hsa-miR-513;hsa-miR-513-5p
Sequence

37 - 

uucacagggaggugucau

 - 54

Get sequence
Deep sequencing 2436 reads, 12 experiments
Evidence experimental; array-cloned [1], cloned [2]
Validated targets
Predicted targets

Mature sequence hsa-miR-513a-3p

Accession MIMAT0004777
Previous IDs hsa-miR-513-3p
Sequence

72 - 

uaaauuucaccuuucugagaagg

 - 94

Get sequence
Deep sequencing 838 reads, 6 experiments
Evidence experimental; cloned [2]
Predicted targets

References

1
PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).