Stem-loop sequence fru-let-7h

AccessionMI0003207 (change log)
DescriptionFugu rubripes let-7h stem-loop
Gene family MIPF0000002; let-7
Stem-loop
   ugu  u                 u     ---------    gaaga 
5'    gg gagguaguaaguugugu guugu         aggg     u
      || ||||||||||||||||| |||||         ||||      
3'    cc uuccgucauucaacaua caaua         uccc     u
   --u  -                 u     gaggacuug    acgug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This Fugu miRNA sequence is predicted based on homology with a verified zebrafish sequence (Mihaela Zavolan, personal communication).

Genome context
Coordinates (FUGU5; GCA_000180615.2) Overlapping transcripts
HE602537.1: 6726015-6726098 [+]
intergenic
Clustered miRNAs
< 10kb from fru-let-7h
fru-let-7gHE602537.1: 6725744-6725822 [+]
fru-let-7hHE602537.1: 6726015-6726098 [+]
Database links

Mature sequence fru-let-7h

Accession MIMAT0002892
Sequence

6 - 

ugagguaguaaguuguguuguu

 - 27

Get sequence
Evidence by similarity; MI0001875