Stem-loop sequence fru-let-7e

AccessionMI0003213 (change log)
DescriptionFugu rubripes let-7e stem-loop
Gene family MIPF0000002; let-7
Stem-loop
       --         uu   gu         a        --------      g 
5' gcug  uccuugggg  gag  aguagauug auaguugu        gggguu u
   ||||  |||||||||  |||  ||||||||| ||||||||        ||||||  
3' cgac  aggaauccu  uuc  ucaucuaac uaucaaua        cuccag g
       ag         --   ug         a        gagugauu      u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This Fugu miRNA sequence is predicted based on homology with a verified zebrafish sequence (Mihaela Zavolan, personal communication).

Genome context
Coordinates (FUGU5; GCA_000180615.2) Overlapping transcripts
HE602537.1: 8251435-8251534 [-]
intergenic
Clustered miRNAs
< 10kb from fru-let-7e
fru-let-7eHE602537.1: 8251435-8251534 [-]
fru-let-7a-3HE602537.1: 8251172-8251265 [-]
Database links

Mature sequence fru-let-7e

Accession MIMAT0002898
Sequence

15 - 

ugagguaguagauugaauaguu

 - 36

Get sequence
Evidence by similarity; MI0001871