Stem-loop sequence tni-let-7e

AccessionMI0003214 (change log)
DescriptionTetraodon nigroviridis let-7e stem-loop
Gene family MIPF0000002; let-7
Stem-loop
       --         cu   gu         a        --------      g 
5' gcug  uccuugggg  gag  aguagauug auaguugu        gggguu u
   ||||  |||||||||  |||  ||||||||| ||||||||        ||||||  
3' cgac  aggaacccu  uuc  ucaucuaac uaucaaua        cuccag g
       ag         --   ug         a        gaguguau      u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This Tetraodon miRNA sequence is predicted based on homology with a verified zebrafish sequence (Mihaela Zavolan, personal communication).

Genome context
Coordinates (Tetraodon8) Overlapping transcripts
9: 4666591-4666690 [+]
intergenic
Database links

Mature sequence tni-let-7e

Accession MIMAT0002899
Sequence

15 - 

ugagguaguagauugaauaguu

 - 36

Get sequence
Evidence by similarity; MI0001871