Stem-loop sequence fru-mir-142

AccessionMI0003223 (change log)
DescriptionFugu rubripes miR-142 stem-loop
Gene family MIPF0000084; mir-142
Stem-loop
          ug   c           a         uaaacuau 
5' acagugc  uca ccauaaaguag aagcacuac        u
   |||||||  ||| ||||||||||| |||||||||         
3' ugucacg  agu gguauuucauc uuugugaug        c
          ug   a           c         ugacacau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This Fugu miRNA sequence is predicted based on homology with a verified zebrafish sequence (Mihaela Zavolan, personal communication).

Genome context
Coordinates (FUGU5; GCA_000180615.2) Overlapping transcripts
HE602545.1: 6894958-6895043 [+]
intergenic
Database links

Mature sequence fru-miR-142

Accession MIMAT0002908
Previous IDsfru-miR-142a
Sequence

15 - 

cauaaaguagaaagcacuacu

 - 35

Get sequence
Evidence by similarity; MI0002005