Stem-loop sequence tni-mir-142a

AccessionMI0003224 (change log)
DescriptionTetraodon nigroviridis miR-142a stem-loop
Gene family MIPF0000084; mir-142
Literature search

1 open access papers mention tni-mir-142a
(7 sentences)

Stem-loop
   gu        g               a         uaaacucu 
5'   acagugca ucauccauaaaguag aagcacuac        u
     |||||||| ||||||||||||||| |||||||||         
3'   ugucaugu aguagguauuucauc uuugugaug        c
   gu        g               c         ugacaccg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This Tetraodon miRNA sequence is predicted based on homology with a verified zebrafish sequence (Mihaela Zavolan, personal communication).

Genome context
Coordinates (Tetraodon8) Overlapping transcripts
7: 2557207-2557296 [+]
intergenic
Database links

Mature sequence tni-miR-142a

Accession MIMAT0002909
Sequence

17 - 

cauaaaguagaaagcacuacu

 - 37

Get sequence
Evidence by similarity; MI0002005