Stem-loop sequence fru-mir-18

AccessionMI0003233 (change log)
DescriptionFugu rubripes miR-18 stem-loop
Gene family MIPF0000001; mir-17
Stem-loop
   -        --   u   uc   u    a   -  aaau 
5'  uugugcua  agg gca  uag gcag uag ug    a
    ||||||||  ||| |||  ||| |||| ||| ||    g
3'  aauacggu  ucc cgu  auc cguc auc ac    a
   g        cu   u   ga   c    -   c  gauc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This Fugu miRNA sequence is predicted based on homology with a verified zebrafish sequence (Mihaela Zavolan, personal communication).

Genome context
Coordinates (FUGU5; GCA_000180615.2) Overlapping transcripts
HE602547.1: 13071440-13071515 [+]
intergenic
Clustered miRNAs
< 10kb from fru-mir-18
fru-mir-17-1HE602547.1: 13071306-13071391 [+]
fru-mir-18HE602547.1: 13071440-13071515 [+]
fru-mir-19aHE602547.1: 13071578-13071658 [+]
fru-mir-19bHE602547.1: 13071933-13071995 [+]
fru-mir-92-2HE602547.1: 13072087-13072149 [+]
Database links

Mature sequence fru-miR-18

Accession MIMAT0002918
Sequence

7 - 

uaaggugcaucuagugcagaua

 - 28

Get sequence
Evidence by similarity; MI0001900