Stem-loop sequence fru-mir-19a

AccessionMI0003235 (change log)
DescriptionFugu rubripes miR-19a stem-loop
Gene family MIPF0000011; mir-19
Stem-loop
   g   uu u  gc             --      u  aagaa 
5'  cag  c cu  uaguuuugcauag  uugcac ac     u
    |||  | ||  |||||||||||||  |||||| ||      
3'  guc  g gg  gucaaaacguauc  aacgug ug     a
   -   cg u  ua             ua      u  aggag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This Fugu miRNA sequence is predicted based on homology with a verified zebrafish sequence (Mihaela Zavolan, personal communication).

Genome context
Coordinates (FUGU5; GCA_000180615.2) Overlapping transcripts
HE602547.1: 13071578-13071658 [+]
intergenic
Clustered miRNAs
< 10kb from fru-mir-19a
fru-mir-17-1HE602547.1: 13071306-13071391 [+]
fru-mir-18HE602547.1: 13071440-13071515 [+]
fru-mir-19aHE602547.1: 13071578-13071658 [+]
fru-mir-19bHE602547.1: 13071933-13071995 [+]
fru-mir-92-2HE602547.1: 13072087-13072149 [+]
Database links

Mature sequence fru-miR-19a

Accession MIMAT0002920
Sequence

49 - 

ugugcaaaucuaugcaaaacuga

 - 71

Get sequence
Evidence by similarity; MI0001903