Stem-loop sequence tni-let-7a-3

AccessionMI0003245 (change log)
DescriptionTetraodon nigroviridis let-7a-3 stem-loop
Gene family MIPF0000002; let-7
Stem-loop
   ------------     u          gu         --------u       gg 
5'             caagg gagguaguag  uguauaguu         gugggau  c
               ||||| ||||||||||  |||||||||         |||||||  u
3'             guucc uuccauuauc  acauaucaa         cauccua  u
   guaacauggaga     -          ug         uauuagacu       gg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This Tetraodon miRNA sequence is predicted based on homology with a verified zebrafish sequence (Mihaela Zavolan, personal communication).

Genome context
Coordinates (Tetraodon8) Overlapping transcripts
11: 8661669-8661764 [-]
intergenic
Un_random: 112904618-112904713 [-]
intergenic
Database links

Mature sequence tni-let-7a

Accession MIMAT0002929
Sequence

6 - 

ugagguaguagguuguauaguu

 - 27

Get sequence
Evidence by similarity; MI0001857